Each leaflet describes an assay for particular FMDV lineages expected to be circulating in a geographical location. A summary of all these real-time RT-PCR assays (found in all the leaflets) can be found here.
LATEST UPDATE
SAT 1/III: April 2026
https://sitesv2.anses.fr/en/minisite/lrue-fievre-aphteuse/new-rt-rt-pcr-detection-sat1iii-fmdv-candidate-assay
https://sitesv2.anses.fr/en/minisite/lrue-fievre-aphteuse/rtrt-pcr-detection-sat1iii-%E2%80%9Cbot177-%E2%80%9D
This real-time RTP-PCR is a molecular tool for the detection of foot-and-mouth disease virus SAT 1/III topotype and was developed at ANSES, the European Union Reference Laboratory for FMD.
Further testing/evaluation of this assay is underway and as more data becomes will this will be updated.
Designated to detect: SAT 1/III
Lineage Specific Assays
- East Africa
- West Eurasia
- O/Me-SA/Ind-2001
- O/ME-SA/SA-2018
- A/G-VII
- SAT 1/I
- SAT 1/III
- SAT 2/IV – Egypt
- SAT 2/V
- SAT 2/XIV
November 2017
This set of specific assays was designed for the detection of FMDV strains currently circulating in the region of East Africa especially Tanzania, Uganda and Kenya (Bachanek-Bankowska et al., 2016). The set of real time RT-PCR assays can detect FMDV serotypes O, A, SAT1 and SAT2 of lineages contemporary and historical in this geographical area.
Designed to detect: O/EA-2, O/EA-4, A/Africa/G-I, SAT 1/I(NWZ) and SAT 2/IV
Primers and probes are listed in the table below.
Oligo Name | Sequence (5’-3’) | Use |
|---|---|---|
| FMDV/A/FP | GCCACRACCATCCACGA | Forward primer |
| FMDV/A/RP | GAAGGGCCCAGGGTTGGACTC | Reverse primer |
| FMDV/A/P | FAM-CTCGTGCGMATGAARCGGGC-BHQ1 | Probe * |
| FMDV/O/FP | CCTCCTTCAAYTACGGTG | Forward primer |
| FMDV/O/RP | GCCACAATCTTYTGTTTGTG | Reverse primer |
| FMDV/O/P | FAM-CCCTCTTCATGCGGTARAGCAG-BHQ1 | Probe * |
| FMDV/SAT1/FP | CTYGACCGGTTCACYCTG | Forward primer |
| FMDV/SAT1/RP | CCGAGAAGTAGTACGTRGC | Reverse primer |
| FMDV/SAT1/P | FAM-CAGGAYTGCGCCCACCA-BHQ1 | Probe * |
| FMDV/SAT2/FP | CRATCCGCGGTGAYCG | Forward primer |
| FMDV/SAT2/RP | CGCTTCATYCTGTAGTARACGTC | Reverse primer |
| FMDV/SAT2/P | FAM-TTTGGACAYGTGACCGCCG-BHQ1 | Probe * |
* Probe oligonucleotide should be ordered to contain the appropriate reporter and quencher for your real time PCR system.
Assay Composition:
The composition of the assay is presented in the table below.
Reagents indicated with an asterisk (*) are part of SuperScript III/ Platinum Taq One-Step qRT-PCR Kit (Invitrogen).
Due to high sensitivity of the test, care needs to be taken when handling samples and reagents to avoid possibility of contamination.
| Reagent | Volume |
|---|---|
| FP (working stock 10 µM) | 2 µl |
| RP (working stock 10 µM) | 2 µl |
| P (working stock 5 µM) | 1 µl |
| SuperScript III RT/Platinum Taq Mix* | 0.5 µl |
| 2x Reaction Mix* | 12.5 µl |
| Nuclease free water | 2 µl |
| RNA | 5 µl |
| total volume | 25 µl |
Thermal Profile:
Amplification of reactions is to be carried out using a real-time PCR instrument under following conditions:
- 60°C for 30 min,
- 95°C for 10 min
- followed by 50 cycles of 95°C for 15 sec and 60°C for 1 min.
Fluorescence data is collected at the annealing/elongation step.
Further Updates
If you use any of these assays, please provide feedback on them to help us improve them.
Any improvements to these assays will be provided here or on the EURL for FMD website.
Leaflet describing the assay
November 2017
This set of real-time RT-PCR type-specific as-says was designed for the detection of FMDV strains currently circulating in West Eurasia (Reid et al., 2014). The set of real-time RT-PCR assays aims to detect FMDV O/ME-SA/PanAsia-2, A/ASIA/Iran05, Asia1/ASIA/Group 1, 2 and 6.
Designed to detect: O/ME-SA/PanAsia-2, A/ASIA/Iran- 05, Asia1/ASIA/Group 1, Asia1/ASIA/Group 2 and Asia1/ASIA/Group 6
Primers and probes are listed in the table below.
Oligo Name | Sequence (5’-3’) | Use |
|---|---|---|
| O/ME-FP | CCGAGACAGCGTTGGATAACA | Forward primer |
| O/ME-RP | CCATACTTGCAGTTCCCGTTGT | Reverse primer |
| O/ME-P | FAM-CCGACTTGCACTGCCTTACACGGC-TAMRA | Probe * |
| A/ME-FP | ACGACCATCCACGAGCTYC | Forward primer |
| A/ME-RP | RCAGAGGCCTGGGACAGTAG | Reverse primer |
| A/ME-P | FAM-CGTGCGCATGAAACGTGCCG-TAMRA | Probe * |
| Asia1/ME-FP | GCAGTWAAGGCYGAGASCATYAC | Forward primer |
| Asia1/ME-RP | GCARAGGCCTAGGGCAGTATG | Reverse primer |
| Asia1/ME-P | FAM-AGCTGTTGATCCGCATGAAACGYGCG-TAMRA | Probe * |
* Probe oligonucleotide should be ordered to contain the appropriate reporter and quencher for your real time PCR system.
Assay Composition:
The composition of the assay is presented in the table below.
Reagents indicated with an asterisk (*) are part of SuperScript III/ Platinum Taq One-Step qRT-PCR Kit (Invitrogen).
Due to high sensitivity of the test, care needs to be taken when handling samples and reagents to avoid possibility of contamination.
| Reagent | Volume |
|---|---|
| FP (working stock 10 µM) | 2 µl |
| RP (working stock 10 µM) | 2 µl |
| P (working stock 5 µM) | 1 µl |
| SuperScript III RT/Platinum Taq Mix* | 0.5 µl |
| 2x Reaction Mix* | 12.5 µl |
| Nuclease free water | 2 µl |
| RNA | 5 µl |
| total volume | 25 µl |
Thermal Profile:
Amplification of reactions is to be carried out using a real-time PCR instrument under following conditions:
- 60°C for 30 min,
- 95°C for 10 min
- followed by 50 cycles of 95°C for 15 sec and 60°C for 1 min.
Fluorescence data is collected at the annealing/elongation step.
Further Updates
If you use any of these assays, please provide feedback on them to help us improve them.
Any improvements to these assays will be provided here or on the EURL for FMD website.
Leaflet describing the assay
November 2017
This FMDV-O Ind-2001-specific real-time RT-PCR is a molecular tool for detection of foot-and-mouth Disease virus O/ME-SA/Ind2001 lineage (Knowles et al., 2014). This lineage was originally detected on the Indian sub-continent, but has since spread westwards through the Middle East to North Africa and eastwards into Southeast Asia.
Designed to detect: O/ME-SA/Ind-2001d
Primers and probes are listed in the table below.
Oligo Name | Sequence (5’-3’) | Use |
|---|---|---|
| Ind2001d-FP | CCTCCTTCAAYTACGGTG | Forward primer |
| Ind2001d-rP | GCCACAATCTTYTGTTTGTG | Reverse primer |
| Ind2001d-P | FAM-CTGCTCGCCATTCACCCG-BHQ-1 | Probe * |
* Probe oligonucleotide should be ordered to contain the appropriate reporter and quencher for your real time PCR system.
Assay Composition:
The composition of the assay is presented in the table below.
Reagents indicated with an asterisk (*) are part of SuperScript III/ Platinum Taq One-Step qRT-PCR Kit (Invitrogen).
Due to high sensitivity of the test, care needs to be taken when handling samples and reagents to avoid possibility of contamination.
| Reagent | Volume |
|---|---|
| FP (working stock 10 µM) | 2 µl |
| RP (working stock 10 µM) | 2 µl |
| P (working stock 5 µM) | 1 µl |
| SuperScript III RT/Platinum Taq Mix* | 0.5 µl |
| 2x Reaction Mix* | 12.5 µl |
| Nuclease free water | 2 µl |
| RNA | 5 µl |
| total volume | 25 µl |
Thermal Profile:
Amplification of reactions is to be carried out using a real-time PCR instrument under following conditions:
- 60°C for 30 min,
- 95°C for 10 min
- followed by 50 cycles of 95°C for 15 sec and 60°C for 1 min.
Fluorescence data is collected at the annealing/elongation step.
Further Updates
If you use any of these assays, please provide feedback on them to help us improve them.
Any improvements to these assays will be provided here or on the EURL for FMD website.
Leaflet describing the assay
January 2025
The following real-time RT-PCR assay is designed to specifically detect the O/ME-SA/SA-2018 lineage of foot-and-mouth disease virus (FMDV).
Designed to detect: O/ME-SA/SA-2018
| Oligo Name | Sequence (5’-3’) | Location (based on O/BAN/DH/Dh-482/2022 VP1 coding sequence) | Use |
|---|---|---|---|
| SA-2018_For | AGAGGTGGCRGTGAAACA | 228-245 | Forward primer |
| SA-2018_Rev | GTGGTARGCCGTTGGATT | 324-307 | Reverse primer |
| SA-2018_Probe 1.2 | CCCGAAAARGCCTTGGACAAC | 280-300 | Probe * |
* Probe oligonucleotide should be ordered to contain the appropriate reporter and quencher for your real time PCR system.
Assay protocol and amplification conditions:
The O/ME-SA/SA-2018 lineage-specific assay has been designed to have identical reagent and cycling conditions as the pan-FMDV real-time RT-PCR assay described in the WOAH manual (Callahan et al., 2002) and testing to date at the WRLFMD indicates that the assay produces Ct values broadly equivalent to the Callahan 3D pan-FMDV assay. Therefore, we suggest that laboratories use their existing real-time RT-PCR strategies (reagents and cycling conditions) and simply replace the 3D or 5’UTR primers and probe with the primers and probe (described above).
Further Updates
If you use any of these assays, please provide feedback on them to help us improve them.
Any improvements to these assays will be provided here or on the EURL for FMD website.
European Union Reference Laboratory for Foot-and-mouth disease
An assay for the O/ME-SA/SA-2018 lineage is also available on the EURL for FMD website.
November 2017
This FMDV-A lineage-VII-specific real-time RT-PCR is a molecular tool for detection of foot-and-mouth Disease virus A/ASIA/G-VII lineage (Saduakassova et al., 2018). This lineage was originally detected on the Indian sub-continent, but has since spread through western Asia.
Designed to detect: A/ASIA/G-VII
Primers and probes are listed in the table below.
Oligo Name | Sequence (5’-3’) | Use |
|---|---|---|
| G-VII_FP | TGCTCAACTCCCTGCCTC | Forward primer |
| G-VII_RP | GAGTTCGGCACGCTTCAT | Reverse primer |
| G-VII_P | FAM-CCACYACCATCCACGAGCTG-BHQ1 | Probe * |
* Probe oligonucleotide should be ordered to contain the appropriate reporter and quencher for your real time PCR system.
Assay Composition:
The composition of the assay is presented in the table below.
Reagents indicated with an asterisk (*) are part of SuperScript III/ Platinum Taq One-Step qRT-PCR Kit (Invitrogen).
Due to high sensitivity of the test, care needs to be taken when handling samples and reagents to avoid possibility of contamination.
| Reagent | Volume |
|---|---|
| FP (working stock 10 µM) | 2 µl |
| RP (working stock 10 µM) | 2 µl |
| P (working stock 5 µM) | 1.5 µl |
| ROX (5 x concentration) | 0.5 μl |
| SuperScript III RT/Platinum Taq Mix* | 1 µl |
| 2x Reaction Mix* | 12.5 µl |
| Nuclease free water | 0.5 µl |
| RNA | 5 µl |
| total volume | 25 µl |
Thermal Profile:
Amplification of reactions is to be carried out using a real-time PCR instrument under following conditions:
- 60°C for 30 min,
- 95°C for 10 min
- followed by 50 cycles of 95°C for 15 sec and 60°C for 1 min.
Fluorescence data is collected at the annealing/elongation step.
Further Updates
If you use any of these assays, please provide feedback on them to help us improve them.
Any improvements to these assays will be provided here or on the EURL for FMD website.
March 2025
In response to the emergence of SAT 1/I in the Middle East during 2025, the following real-time RT-PCR assay (as described by Bachanek-Bankowska et al., 2016) has been tested for representative samples from the region. Data from WRLFMD indicate that this assay is able to detect viruses from the SAT 1/I lineage.
Designed to detect: SAT 1/I
| Oligo Name | Sequence (5’-3’) | Use |
|---|---|---|
| FMDV/SAT1/FP | CTYGACCGGTTCACYCTG | Forward primer |
| FMDV/SAT1/RP | CCGAGAAGTAGTACGTRGC | Reverse primer |
| FMDV/SAT1/P | CAGGAYTGCGCCCACCA | Probe* |
* Probe oligonucleotide should be ordered to contain the appropriate reporter and quencher for your real time PCR system.
width="one-half"
Assay protocol and amplification conditions:
This SAT1 assay was designed to have identical reagent and cycling conditions as the pan-FMDV real-time RT-PCR assay described in the WOAH manual (Callahan et al., 2002) and testing to date at the WRLFMD indicates that the assay produces Ct values broadly equivalent to the Callahan 3D pan-FMDV assay. Therefore, to perform this test, we suggest that laboratories use their existing real-time RT-PCR strategies (reagents and cycling conditions) and simply replace the 3D or 5’UTR primers and probe with the primers and probe described above. This should be done in conjunction with a pan-FMDV real-time RT-PCR assay.
Further Updates
If you use any of these assays, please provide feedback on them to help us improve them.
Any improvements to these assays will be provided here or on the EURL for FMD website.
April 2026
https://sitesv2.anses.fr/en/minisite/lrue-fievre-aphteuse/new-rt-rt-pcr-detection-sat1iii-fmdv-candidate-assay
https://sitesv2.anses.fr/en/minisite/lrue-fievre-aphteuse/rtrt-pcr-detection-sat1iii-%E2%80%9Cbot177-%E2%80%9DDesigned to detect: SAT 1/III
This real-time RTP-PCR is a molecular tool for the detection of foot-and-mouth disease virus SAT 1/III topotype and was developed at ANSES, the European Union Reference Laboratory for FMD.
Further testing/evaluation of this assay is underway and as more data becomes will this will be updated.
Designated to detect: SAT 1/III
November 2017
This real-time RT-PCR is a molecular tool for detection of Foot-and-mouth disease virus SAT 2/VII topotype and was developed in response to the SAT 2 outbreak in Egypt in 2012 (Ahmed et al., 2012). Outside of Egypt this lineage has been detected in Libya, Palestinian Autonomous Territories, Eritrea and Cameroon.
Designed to detect: SAT 2/VII
Primers and probes are listed in the table below.
Oligo Name | Sequence (5’-3’) | Use |
|---|---|---|
| SAT2/VII-FP | TGAAGAGGGCTGAGCTGTACTG | Forward primer |
| SAT2/VII-RP | CTCAACGTCTCCTGCCAGTTT | Reverse primer |
| SAT2/VII-P | FAM-ACAGATTCGACGCGCCCATCG-TAMRA | Probe * |
* Probe oligonucleotide should be ordered to contain the appropriate reporter and quencher for your real time PCR system.
Assay Composition:
The composition of the assay is presented in the table below.
Reagents indicated with an asterisk (*) are part of SuperScript III/ Platinum Taq One-Step qRT-PCR Kit (Invitrogen).
Due to high sensitivity of the test, care needs to be taken when handling samples and reagents to avoid possibility of contamination.
| Reagent | Volume |
|---|---|
| FP (working stock 10 µM) | 2 µl |
| RP (working stock 10 µM) | 2 µl |
| P (working stock 5 µM) | 1 µl |
| SuperScript III RT/Platinum Taq Mix* | 0.5 µl |
| 2x Reaction Mix* | 12.5 µl |
| Nuclease free water | 2 µl |
| RNA | 5 µl |
| total volume | 25 µl |
Thermal Profile:
Amplification of reactions is to be carried out using a real-time PCR instrument under following conditions:
- 60°C for 30 min,
- 95°C for 10 min
- followed by 50 cycles of 95°C for 15 sec and 60°C for 1 min.
Fluorescence data is collected at the annealing/elongation step.
Further Updates
If you use any of these assays, please provide feedback on them to help us improve them.
Any improvements to these assays will be provided here or on the EURL for FMD website.
Leaflet describing the assay
September 2025
https://eurl-fmd.anses.fr/en/minisite/lrue-fievre-aphteuse/rtrt-pcr-detection-sat2v-fmdv
Designed to detect: SAT 2/V
This real-time RTP-PCR is a molecular tool for the detection of foot-and-mouth disease virus SAT 2/V topotype and was developed at ANSES, the European Union Reference Laboratory for FMD.
Designated to detect: SAT 2/V
February-March 2023
FMDV SAT 2 outbreaks in Iraq and Jordan due to SAT2/XIV. The results presented here are a preliminary evaluation of a second real-time RT-PCR assay for the detection of SAT2/XIV viruses that have caused these outbreaks
Designed to detect: SAT 2/XIV
Primers and probes are listed in the table below.
| Oligo Name | Sequence (5’-3’) | Location (based on SAT2/ETH/2/2022 full genome) | Use |
|---|---|---|---|
| SAT2_XIV_AS_P | CCTCCACTGCCATCCGCGGTGAYAGG | 3663-3688 | Probe * |
| SAT2_XIV_AS_F | ACCGTGTACAACGGTGAGTG | 3629-3648 | Forward primer |
| SAT2_XIV_AS_R | TCAGCGTACTTGGCCRCAAG | 3714-3695 | Reverse primer |
* Probe oligonucleotide should be ordered to contain the appropriate reporter and quencher for your real time PCR system.
Assay protocol and amplification conditions:
The SAT2/XIV lineage-specific assay has been designed to have identical reagent and cycling conditions as the pan-FMDV real-time RT-PCR assay described in the WOAH manual (Callahan et al., 2002) and preliminary testing at the WRLFMD indicates that these condition are suitable for this test. Therefore, we suggest that laboratories use their existing real-time RT-PCR strategies (reagents and cycling conditions) and simply replace the 3D or 5’UTR primers and probe with the primers and probe (described above).
7 March 2023 Results from initial testing of new assay at the WRLFMD
This latest assay has been shown to be able to detect nucleic acid extracted from a sample containing SAT/XIV FMD virus from Iraq where Ct values were broadly equivalent to the results from the pan-serotypic 3D real-time RT-PCR. Preliminary lineage specificity testing indicates that this assay does not detect FMD viruses from serotype O (O/EA-3, O/ME-SA/PanAsia-2ANT-10, O/ME-SA/PanAsia-2QOM-15, O/ME-SA/Ind-2001e), serotype A (A/ASIA/Iran-05), serotype Asia 1 (Sindh-08) and serotype SAT2 (VII).