April 2026
This is a two stage process. The first stage is to use RT-PCR to amplify the VP1-coding region of a SAT 1 positive sample. Two separate primer sets are described below to generate these products.
The second stage is to sequence the amplified RT-PCR products
First Stage - amplify the SAT 1 sample
Two primer combinations are used to amplify the SAT 1 sample:
- SAT1-1C559F with SAT-2B208R
- UNI-SAT-VP3-F1 with SAT-2B208R
| Primer combination | Oligo Name | Sequence (5’-3’) | Orientation | Thermal profile |
|---|---|---|---|---|
| 1 | SAT1-1C559F | GTGTATCAGATCACAGACACACA | Forward | Profile 1 |
| SAT-2B-208R | ACAGCGGCCATGCACGACAG | Reverse | ||
| 2 | UNI-SAT-VP3-F1 * | CACTGYYACCACKCDGARTGGGACAC | Forward | Profile 2 |
| SAT-2B-208R | ACAGCGGCCATGCACGACAG | Reverse |
*This primer was designed by ARC-OVR South Africa
Suggested composition of reaction mixes for One-step RT-PCR:
| Reaction component | 1 reaction |
|---|---|
| 5x QIAGEN OneStep RT-PCR buffer (containing 12.5 mM MgCl2) | 5.0 µl |
| Forward primer (4 pmol/μl) | 2.5 µl |
| Reverse primer (4 pmol/μl) | 5.0µl |
| RNase free water | 8.0 µl |
| dNTP mix (containing 10 mM of each dNTP) | 1.0 µl |
| QIAGEN OneStep RT-PCR enzyme mix | 1.0 µl |
| RNA | 2.5 µl |
| Total Volume | 25.0µl |
Thermal Profile: Profile 1
Protocol | Temperature | Time | No. of cycles |
|---|---|---|---|
Profile 1 | 50 °C | 30 min | 1 |
95 °C | 15 min | 1 | |
95 °C | 60 sec | 35 | |
50 °C | 60 sec | ||
72 °C | 120 sec | ||
72 °C | 5 min | 1 |
Thermal Profile: Profile 2
Protocol | Temperature | Time | No. of cycles |
|---|---|---|---|
Profile 2 | 50 °C | 30 min | 1 |
95 °C | 15 min | 1 | |
95 °C | 60 sec | 35 | |
55 °C | 60 sec | ||
72 °C | 120 sec | ||
72 °C | 5 min | 1 |
Second Stage - sequence the amplification products
For both amplification products, sequence with the NK72, SAT1-1D200F & SAT1-1D394R primers.
Additionally, for the UNI-SAT-VP3-F1/SAT-2B208R RT-PCR amplification product, primer UNI-SAT-VP3-F1 can be used.
Oligo Name | Sequence (5’-3’) | Orientation | Use |
|---|---|---|---|
| NK72 | GAAGGGCCCAGGGTTGGACTC | Reverse | Sequencing primer |
| SAT1-1D200F | TGCGYGCIGCCACGTACTAYTTCTC | Forward | Sequencing primer |
| SAT1-1D394R | GGYTTGTACTTRCARTCACCGTTGTA | Reverse | Sequencing primer |
| UNI-SAT-VP3-F1 * | CACTGYYACCACKCDGARTGGGACAC | Forward | Amplification & sequencing primer |
*This primer was designed by ARC-OVR South Africa
Technical Queries
Please send any technical queries to Donald King (donald.king@pirbright.ac.uk) and Jemma Wadsworth (jemma.wadsworth@pirbright.ac.uk).